ID: 1000977783_1000977787

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1000977783 1000977787
Species Human (GRCh38) Human (GRCh38)
Location 5:167783749-167783771 5:167783771-167783793
Sequence CCTACCAGCAAATCGCTTGGTCC CTGCTGAGGAATCACACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 35} {0: 1, 1: 0, 2: 0, 3: 23, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!