ID: 1000977784_1000977789

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1000977784 1000977789
Species Human (GRCh38) Human (GRCh38)
Location 5:167783753-167783775 5:167783777-167783799
Sequence CCAGCAAATCGCTTGGTCCTGCT AGGAATCACACAGATGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85} {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!