ID: 1001144902_1001144911

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1001144902 1001144911
Species Human (GRCh38) Human (GRCh38)
Location 5:169175356-169175378 5:169175384-169175406
Sequence CCCTCTTCCCACTCCTAGTACAC GGTTAATGGGTTAGGCAATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 225} {0: 1, 1: 0, 2: 1, 3: 11, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!