ID: 1001181642_1001181648

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1001181642 1001181648
Species Human (GRCh38) Human (GRCh38)
Location 5:169526096-169526118 5:169526112-169526134
Sequence CCGACCCCACATTTCCCTTCCAC CTTCCACATTGCCCTAGCACAGG
Strand - +
Off-target summary {0: 229, 1: 457, 2: 903, 3: 1206, 4: 1521} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!