|
Left Crispr |
Right Crispr |
Crispr ID |
1001181644 |
1001181652 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:169526101-169526123
|
5:169526124-169526146
|
Sequence |
CCCACATTTCCCTTCCACATTGC |
CCTAGCACAGGTTCTCCATGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 35, 1: 497, 2: 807, 3: 1549, 4: 2077} |
{0: 20, 1: 1107, 2: 1623, 3: 1385, 4: 1078} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|