ID: 1001181645_1001181659

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1001181645 1001181659
Species Human (GRCh38) Human (GRCh38)
Location 5:169526102-169526124 5:169526155-169526177
Sequence CCACATTTCCCTTCCACATTGCC CCTGTAGCAAACTTTTGACTGGG
Strand - +
Off-target summary {0: 37, 1: 477, 2: 848, 3: 1564, 4: 2094} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!