ID: 1001212080_1001212084

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1001212080 1001212084
Species Human (GRCh38) Human (GRCh38)
Location 5:169819446-169819468 5:169819463-169819485
Sequence CCCTACACCTACAAAAAATTAAA ATTAAAAAATTAGCTGGTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 37, 3: 403, 4: 3676} {0: 8, 1: 334, 2: 3578, 3: 44207, 4: 105518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!