|
Left Crispr |
Right Crispr |
| Crispr ID |
1001212080 |
1001212086 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:169819446-169819468
|
5:169819494-169819516
|
| Sequence |
CCCTACACCTACAAAAAATTAAA |
ACCTGTAGTCCCGGCTACTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 37, 3: 403, 4: 3676} |
{0: 187, 1: 29475, 2: 149631, 3: 248215, 4: 217023} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|