ID: 1001501739_1001501741

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1001501739 1001501741
Species Human (GRCh38) Human (GRCh38)
Location 5:172242009-172242031 5:172242025-172242047
Sequence CCCTCATGAATGGCTTGGTGCCC GGTGCCCTTCCCATGAGATCTGG
Strand - +
Off-target summary {0: 151, 1: 509, 2: 875, 3: 1153, 4: 1701} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!