| ID: 1001501740_1001501741 | View in Genome Browser | 
| Spacer: -8 | 
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1001501740 | 1001501741 | 
| Species | Human (GRCh38) | Human (GRCh38) | 
| Location | 5:172242010-172242032 | 5:172242025-172242047 | 
| Sequence | CCTCATGAATGGCTTGGTGCCCT | GGTGCCCTTCCCATGAGATCTGG | 
| Strand | - | + | 
| Off-target summary | {0: 159, 1: 460, 2: 896, 3: 1135, 4: 1606} | No data | 
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||