ID: 1001594807_1001594812

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1001594807 1001594812
Species Human (GRCh38) Human (GRCh38)
Location 5:172891341-172891363 5:172891365-172891387
Sequence CCATCCTCTTCCCTCTTCTCCAT TCTGCAGTCTCTCCCTTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 48, 3: 398, 4: 2874} {0: 1, 1: 0, 2: 1, 3: 21, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!