ID: 1001842997_1001842999

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1001842997 1001842999
Species Human (GRCh38) Human (GRCh38)
Location 5:174895410-174895432 5:174895430-174895452
Sequence CCTCAGATCATCAGGCATTAATT ATTAGATTCTAAGAAGGTGCAGG
Strand - +
Off-target summary {0: 23, 1: 357, 2: 1055, 3: 915, 4: 634} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!