ID: 1002139931_1002139947

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1002139931 1002139947
Species Human (GRCh38) Human (GRCh38)
Location 5:177132571-177132593 5:177132620-177132642
Sequence CCGGGCTGGGGACTCGGCCTCCC CGAGGTGCGGACGCGCTGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!