ID: 1002158770_1002158781

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1002158770 1002158781
Species Human (GRCh38) Human (GRCh38)
Location 5:177303008-177303030 5:177303054-177303076
Sequence CCCAAATACCTAATGTCACAGTC GGCCACGAAGGCGGCCCCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137} {0: 1, 1: 0, 2: 0, 3: 19, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!