ID: 1002201342_1002201347

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1002201342 1002201347
Species Human (GRCh38) Human (GRCh38)
Location 5:177530420-177530442 5:177530435-177530457
Sequence CCTGCCTCCATCTCCCTCTCCTG CTCTCCTGCCATCAGATCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 409, 4: 1839} {0: 1, 1: 0, 2: 0, 3: 15, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!