ID: 1002313979_1002313992

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1002313979 1002313992
Species Human (GRCh38) Human (GRCh38)
Location 5:178331557-178331579 5:178331606-178331628
Sequence CCCTCGGGGCAGGGTGCGGAGCA GCAGCCACCGACAGGAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113} {0: 1, 1: 0, 2: 1, 3: 13, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!