ID: 1002348012_1002348022

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1002348012 1002348022
Species Human (GRCh38) Human (GRCh38)
Location 5:178561444-178561466 5:178561486-178561508
Sequence CCTACAATGCAGGGACTGCTCTG GAACCCTATGGGCACCCCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!