ID: 1002452379_1002452390

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1002452379 1002452390
Species Human (GRCh38) Human (GRCh38)
Location 5:179326254-179326276 5:179326302-179326324
Sequence CCCAGGAATGCTGTATTGGCGGG GCCATGTCCTGAGGGGCTCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40} {0: 1, 1: 0, 2: 2, 3: 13, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!