ID: 1002522351_1002522359

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1002522351 1002522359
Species Human (GRCh38) Human (GRCh38)
Location 5:179798758-179798780 5:179798809-179798831
Sequence CCCTGAGCTCCTAGGGGCTGCCT TACGAGGCCCACTTCAGATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 283} {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!