ID: 1002522352_1002522359

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1002522352 1002522359
Species Human (GRCh38) Human (GRCh38)
Location 5:179798759-179798781 5:179798809-179798831
Sequence CCTGAGCTCCTAGGGGCTGCCTG TACGAGGCCCACTTCAGATGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 310} {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!