ID: 1002536969_1002536973

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1002536969 1002536973
Species Human (GRCh38) Human (GRCh38)
Location 5:179881132-179881154 5:179881171-179881193
Sequence CCAAGCTCAGGGACCAGGCGGCT CTCAAGTCCCACCTTACATTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!