ID: 1002596570_1002596572

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1002596570 1002596572
Species Human (GRCh38) Human (GRCh38)
Location 5:180327634-180327656 5:180327652-180327674
Sequence CCCAGCACACAGTAAGTGCACAG CACAGTAAATATTAGTTGCATGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 88, 3: 558, 4: 2264} {0: 1, 1: 0, 2: 5, 3: 57, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!