ID: 1002596570_1002596573

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1002596570 1002596573
Species Human (GRCh38) Human (GRCh38)
Location 5:180327634-180327656 5:180327656-180327678
Sequence CCCAGCACACAGTAAGTGCACAG GTAAATATTAGTTGCATGGTTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 88, 3: 558, 4: 2264} {0: 1, 1: 0, 2: 0, 3: 20, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!