ID: 1002790753_1002790762

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1002790753 1002790762
Species Human (GRCh38) Human (GRCh38)
Location 6:435848-435870 6:435877-435899
Sequence CCCACGCCCACCCGGAACTCGCG CGCAAGCGCCGCGCACAGTCCGG
Strand - +
Off-target summary {0: 114, 1: 223, 2: 761, 3: 668, 4: 406} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!