ID: 1002887874_1002887885

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1002887874 1002887885
Species Human (GRCh38) Human (GRCh38)
Location 6:1312192-1312214 6:1312231-1312253
Sequence CCGCGGGTGCTCAAGGCTGAAGG ACGGTGGCACGCACATCATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 177} {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!