ID: 1002887879_1002887889

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1002887879 1002887889
Species Human (GRCh38) Human (GRCh38)
Location 6:1312217-1312239 6:1312264-1312286
Sequence CCGGACCTTCCCCCACGGTGGCA GTGCCCCGAAGACGCCCGCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 2, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!