ID: 1003009512_1003009516

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1003009512 1003009516
Species Human (GRCh38) Human (GRCh38)
Location 6:2413629-2413651 6:2413682-2413704
Sequence CCTGAGCACGTGCATGCAAACAC TTTTTTTTTCTTTCTGAGACAGG
Strand - +
Off-target summary No data {0: 26, 1: 919, 2: 15534, 3: 22242, 4: 37711}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!