ID: 1003018979_1003018980

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1003018979 1003018980
Species Human (GRCh38) Human (GRCh38)
Location 6:2493595-2493617 6:2493617-2493639
Sequence CCAGGCTGGCGCAATCTCTGATC CACTGCAACCTCCGCCTCCCAGG
Strand - +
Off-target summary No data {0: 33522, 1: 160300, 2: 208179, 3: 148545, 4: 88541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!