ID: 1003062821_1003062825

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1003062821 1003062825
Species Human (GRCh38) Human (GRCh38)
Location 6:2876069-2876091 6:2876082-2876104
Sequence CCTGCAGCGCTCGGTTTCCCCCG GTTTCCCCCGCGGGGCAGCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!