ID: 1003081714_1003081723

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1003081714 1003081723
Species Human (GRCh38) Human (GRCh38)
Location 6:3026599-3026621 6:3026634-3026656
Sequence CCTGTCAGGAGAAACCTTCCCCA GAGGAGCTTGAAATCCTGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 264} {0: 1, 1: 0, 2: 0, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!