ID: 1003081721_1003081730

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1003081721 1003081730
Species Human (GRCh38) Human (GRCh38)
Location 6:3026629-3026651 6:3026668-3026690
Sequence CCCAGGAGGAGCTTGAAATCCTG CCCAGGTGCTGACCCTGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 116, 4: 3317} {0: 1, 1: 0, 2: 4, 3: 67, 4: 1484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!