ID: 1003209085_1003209089

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003209085 1003209089
Species Human (GRCh38) Human (GRCh38)
Location 6:4043456-4043478 6:4043493-4043515
Sequence CCATCAGTGGGGTCTGCAGCAGA ACGTTAATATTTCTACAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 228} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!