ID: 1003233410_1003233413

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1003233410 1003233413
Species Human (GRCh38) Human (GRCh38)
Location 6:4274968-4274990 6:4275003-4275025
Sequence CCAACCTCTATATGGCAACACAG GAAAGGAACTGTGTTACAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!