ID: 1003317851_1003317867

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1003317851 1003317867
Species Human (GRCh38) Human (GRCh38)
Location 6:5027823-5027845 6:5027868-5027890
Sequence CCGCAGCCTTTCCCTTTCAGGGT GAGGGCTGGGCACAGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 393} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!