ID: 1003409584_1003409596

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1003409584 1003409596
Species Human (GRCh38) Human (GRCh38)
Location 6:5850844-5850866 6:5850889-5850911
Sequence CCTGACCAGCTGGGGATCCTGGC ATTTTCTAGGGTGTGTTCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 42, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!