ID: 1003556040_1003556056

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1003556040 1003556056
Species Human (GRCh38) Human (GRCh38)
Location 6:7141142-7141164 6:7141193-7141215
Sequence CCCCAGGGCTCCCGCGGTGGGTG TCAGGGCGGCGGGCGCCGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 165} {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!