ID: 1003556041_1003556048

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1003556041 1003556048
Species Human (GRCh38) Human (GRCh38)
Location 6:7141143-7141165 6:7141163-7141185
Sequence CCCAGGGCTCCCGCGGTGGGTGT TGTCCGGTGAGCGGGTAGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156} {0: 1, 1: 0, 2: 0, 3: 5, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!