ID: 1003556049_1003556056

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1003556049 1003556056
Species Human (GRCh38) Human (GRCh38)
Location 6:7141166-7141188 6:7141193-7141215
Sequence CCGGTGAGCGGGTAGCGAGGCCA TCAGGGCGGCGGGCGCCGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67} {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!