ID: 1003623256_1003623258

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1003623256 1003623258
Species Human (GRCh38) Human (GRCh38)
Location 6:7720887-7720909 6:7720918-7720940
Sequence CCTGGCTCTTATCTGGAGGCTCT ATCTGCTTCTAGGCTTATTCAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 8, 3: 23, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!