ID: 1003702512_1003702517

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1003702512 1003702517
Species Human (GRCh38) Human (GRCh38)
Location 6:8484294-8484316 6:8484347-8484369
Sequence CCTGAAGGCAGAGTCCATACAAT TACTGTTGTCCCTAACAAAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!