ID: 1003758379_1003758381

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1003758379 1003758381
Species Human (GRCh38) Human (GRCh38)
Location 6:9148306-9148328 6:9148319-9148341
Sequence CCATCAAAGGCCAGGTGGGTGTA GGTGGGTGTAACTACCGTAATGG
Strand - +
Off-target summary {0: 2, 1: 33, 2: 47, 3: 110, 4: 193} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!