|
Left Crispr |
Right Crispr |
Crispr ID |
1003820676 |
1003820683 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:9893373-9893395
|
6:9893396-9893418
|
Sequence |
CCCAGCACTTTGGGAGGCCAAGA |
CGGGTGGGTTACCTGAAGTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 5583, 1: 99313, 2: 221046, 3: 234614, 4: 143836} |
{0: 1, 1: 49, 2: 1708, 3: 20920, 4: 68132} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|