ID: 1003860668_1003860673

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1003860668 1003860673
Species Human (GRCh38) Human (GRCh38)
Location 6:10319389-10319411 6:10319402-10319424
Sequence CCGTGGGGATAGAGGGACGTGGG GGGACGTGGGGGTTTTCCGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!