ID: 1003981530_1003981535

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1003981530 1003981535
Species Human (GRCh38) Human (GRCh38)
Location 6:11394816-11394838 6:11394864-11394886
Sequence CCTGGGGTTAAGAAAAGGCTCAG TCATGTCCTTTGCAGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 172} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!