ID: 1004222271_1004222277

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1004222271 1004222277
Species Human (GRCh38) Human (GRCh38)
Location 6:13757042-13757064 6:13757057-13757079
Sequence CCTGTAATCCCAGCACTTTGGGA CTTTGGGAGGCGAAGGTGGATGG
Strand - +
Off-target summary {0: 284556, 1: 262309, 2: 153276, 3: 130613, 4: 189623} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!