ID: 1004249013_1004249017

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1004249013 1004249017
Species Human (GRCh38) Human (GRCh38)
Location 6:14007082-14007104 6:14007127-14007149
Sequence CCATTTCATTCGCTTTCTTCCTC TCAGAATTCATGGCTCTCTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 92, 4: 1221} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!