ID: 1004394026_1004394034

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1004394026 1004394034
Species Human (GRCh38) Human (GRCh38)
Location 6:15232645-15232667 6:15232693-15232715
Sequence CCGAGTAGCTGGGACTACAGGTG TTGTATCTTTAGGAGAGGCAGGG
Strand - +
Off-target summary {0: 27099, 1: 99923, 2: 128146, 3: 148395, 4: 176885} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!