ID: 1004394027_1004394034

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1004394027 1004394034
Species Human (GRCh38) Human (GRCh38)
Location 6:15232672-15232694 6:15232693-15232715
Sequence CCACCATGCCCAGCTAATTTTTT TTGTATCTTTAGGAGAGGCAGGG
Strand - +
Off-target summary {0: 12741, 1: 68316, 2: 142002, 3: 198072, 4: 178225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!