ID: 1004394028_1004394034

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1004394028 1004394034
Species Human (GRCh38) Human (GRCh38)
Location 6:15232675-15232697 6:15232693-15232715
Sequence CCATGCCCAGCTAATTTTTTGTA TTGTATCTTTAGGAGAGGCAGGG
Strand - +
Off-target summary {0: 6108, 1: 20643, 2: 47272, 3: 60094, 4: 100913} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!