ID: 1004394029_1004394034

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1004394029 1004394034
Species Human (GRCh38) Human (GRCh38)
Location 6:15232680-15232702 6:15232693-15232715
Sequence CCCAGCTAATTTTTTGTATCTTT TTGTATCTTTAGGAGAGGCAGGG
Strand - +
Off-target summary {0: 372, 1: 20905, 2: 70190, 3: 47624, 4: 47812} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!